The Purdue strain of TGEV (ATCC VR-763) was obtained from the American Type Culture Collection and passaged once in swine testicular (ST) cells. ST cells were obtained from the American Type Culture Collection (ATCC 1746-CRL) and maintained in minimal essential medium containing 10% fetal clone II (HyClone Laboratories, Inc., Logan, Utah) and supplemented with 0.5% lactalbumin hydrolysate, 1× nonessential amino acids, 1 mM sodium pyruvate, kanamycin (0.25 μg/ml), and gentamicin (0.05 μg/ml). Baby hamster kidney (BHK) cells (BHK-21 [ATCC CCL10]) were maintained in alpha-minimal essential medium containing 10% fetal calf serum supplemented with 10% tryptose phosphate broth, kanamycin (0.25 μg/ml), and gentamicin (0.05 μg/ml). To determine the effect of co-infection with TGEV and VEE VRPs on TGEV growth rate, cultures of ST cells (5×105) were infected with wild-type TGEV alone or with wild-type TGEV and VEE VRPs encoding a Norwalk-like virus (VEE-NCFL) capsid antigen (ORF 2) at a multiplicity of infection (MOI) of 5 for 1 h (Harrington, et al. (2002) J. Virol. 76:730-742). The cells were washed twice with phosphate-buffered saline (PBS) to remove residual virus and VEE VRPs, and the cells were subsequently incubated at 37° C. in complete medium. At different times post-infection, progeny virions were harvested and assayed by plaque assay in ST cells, as previously described (Yount, et al. (2000) J. Virol. 74:10600-10611).EXAMPLE 2Recombinant DNA Manipulations of TGEV F Subclone
Plasmid DNAs were amplified in Escherichia coli DH5α and purified with the QIAprep Miniprep kit (Qiagen Inc., Valencia, Calif.). All enzymes were purchased from New England BioLabs (Beverly, Mass.) and used according to the manufacturer’s directions. DNA fragments were isolated from Tris-acetate-EDTA agarose gels (0.8%) with the QIAEX II gel extraction kit (Qiagen Inc.). All DNA was visualized using Dark Reader technology (Clare Chemical Research, Denver, Colo.) to prevent UV-induced DNA damage that could impact subsequent manipulations, including in vitro transcription. It was found that increased concentrations of full-length transcripts and increased transfection efficiencies were achieved after Dark Reader technology was used to isolate the TGEV cDNAs.
Six subgenomic cDNA clones (A to F) spanning the entire TGEV genome were isolated using standard molecular techniques as previously described (Yount, et al. (2000) J. Virol. 74:10600-10611). The 3′ end of the TGEV genome, carrying the S, ORF 3A, ORF 3B, E, M, N, and ORF S genes, is contained within the 5.1-kb TGEV F subclone. To generate TGEV cDNA constructs containing a reporter gene, nucleotides 24828 to 25073 (GenBank accession no. AJ271965), corresponding to ORF 3A, were removed and replaced with the ClaI and PflMI restriction sites using conventional recombinant DNA techniques such that the adjacent ORFs (S and 3B) were not disrupted (Sambrook, et al. (1989) Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). The ClaI site was inserted 25 nt downstream of the 3A TSE, while the PflMI and ScaI sites are located just upstream of the ORF 3B TSE or downstream of the ORF 3B ATG start codon, respectively (FIG. 1A). To potentially enhance GFP expression, the mammalian codon-optimized version of the GFP gene was isolated from the noncytopathic Sindbis virus vector pSINrep19/GFP (kindly provided by Charlie Rice, Columbia University) and was inserted with or without a 5′ 20-nt N gene TSE (TGGTATAACTAAACTTCTAA; SEQ ID NO:17) into the TGEV genome (FIG. 1B). The TGEV ORF 3A (ClaI/PflMI digestion), and in some instances a portion of ORF 3B (ClaI/ScaI digestion), were removed and replaced with GFP in several orientations (FIG. 1A) using standard recombinant DNA techniques (Sambrook, et al. (1989) Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). In TGEV iGFP2(ScaI), an ATG start codon was inserted between the ORF 3A and N TSEs to ablate expression from ORF 3A TSE-derived transcripts (FIG. 1B). Clones were identified by DNA sequencing using an ABI model 377 automated sequencer and constructs TGEV pFiGFP2(PflMI) and TGEV iGFP2(ScaI) were subsequently used in the assembly of recombinant TGEV viral cDNA and as the backbone for the construction of structural gene deletions (FIG. 1D).EXAMPLE 3Assembly of Full-Length TGEV cDNAs
The six cDNA subclones spanning the entire TGEV genome, including the FiGFP2(PflMI) and FiGFP2(PflMI) deletion subclones, were used to assemble TGEV viral and replicon constructs, respectively, as previously described (FIG. 1D) (Yount, et al. (2000) J. Virol. 74:10600-10611; Curtis, et al. (2002) J. Virol. 76:1422-1434). The TGEV A fragment contains a T7 promoter while the TGEV FiGFP2(PflMI), FiGFP2-AvrII, and FiGFP2-EcoNI fragments terminate in a 25-nt poly(T) tract and a unique NotI site at the 3′ end, allowing for in vitro T7 transcription of capped, polyadenylated transcripts (FIG. 1C). To assemble full-length TGEV recombinant virus and subgenomic replicon cDNAs, plasmids were digested with BglI and BstXI or NotI, and the appropriately-sized inserts were isolated from agarose gels. The TGEV A-B1, B2-C, and DE-1-FiGFP2 fragments were ligated overnight at 4° C. in the presence of T4 DNA ligase, according to the manufacturer’s directions. Systematically, assembled products were isolated and extracted from agarose gels, and the TGEV A-B1, B2-C, and DE-1-FiGFP2 fragments were religated overnight. The final ligation products were purified by phenol-chloroform-isoamyl alcohol and chloroform extraction, precipitated under isopropanol, and washed with 70 and 90% ethanol. Purified TGEV full-length viral and replicon cDNA constructs, designated TGEV-GFP2(PflMI), TGEV-Rep(AvrII), and TGEV-Rep(EcoNI), were subsequently used for T7 in vitro transcription. The resulting replicon RNAs from Rep(AvrII) and TGEV-Rep(EcoNI) T7 in vitro transcription were ˜29.1 kb and 28.4 kb, respectively.EXAMPLE 4TGEV in vitro Transcription and Transfection
The TGEV A fragment contains a T7 promoter while the TGEV FiGFP2(PflMI) fragment has a poly(T) tract at its very 3′ end, allowing for in vitro T7 transcription of capped, polyadenylated mRNAs. Capped, runoff T7 transcripts were synthesized in vitro from assembled TGEV and replicon cDNAs using the MMESSAGE MMACHINE™ kit as described by the manufacturer (Ambion, Austin, Tex.), with certain modifications. TGEV RNA transcription reaction mixtures (50-μl volume) were prepared containing 7.5 μl of a 30 mM GTP stock and incubated at 37° C. for 2 h. Similar reactions were performed using 1 μl of PCR amplicons carrying the TGEV N gene sequence and 1 μg of pVR21-E1, each containing a 2:1 ratio of cap analog to GTP. A portion of the RNA transcripts (5 μl of the 50-μl reaction volume) were treated with DNase I, denatured, and separated in 0.5% agarose gels in Tris-acetate-EDTA buffer containing 0.1% sodium dodecyl sulfate. The remaining RNA transcripts were mixed with transcripts encoding TGEV N and directly electroporated into BHK cells. As a control, separate transcription reaction mixtures were treated with RNase A for 15 min at room temperature prior to transfection. Using transcripts driven from various pSin replicons as a control, it was predicted that the transcripts generated from the replicon cDNAs were likely of the appropriate lengths.
BHK cells were grown to subconfluence (˜70%), trypsinized, washed twice with PBS, and resuspended in PBS at a concentration of 107 cells/ml. RNA transcripts were added to 800 μl of the cell suspension (8×106 cells) in an electroporation cuvette, and three electrical pulses of 850 V at 25 μF were given with a Bio-Rad Gene Pulser II electroporator. N gene transcripts (lacking the TGEV leader sequence) were included in all electroporations, as these transcripts may enhance the recovery of infectious TGEV virions derived from the full-length cDNA construct, TGEV 1000 (Yount, et al. (2000) J. Virol. 74:10600-10611). The BHK cells were either seeded alone or, in some instances, mixed with 106 ST cells in a 75-cm2 flask and incubated at 37° C. in 5% CO2. Aliquots of cell culture supernatants were harvested ˜36 h post-electroporation, and fresh cultures of ST cells were infected for 1 h at room temperature and subsequently incubated at 37° C. in complete medium.
Recombinant TGEV strains all displayed growth kinetics similar to those of wild-type TGEV generated from the TGEV 1000 infectious construct, with all viruses growing to ˜108 PFU/ml in ˜20 h (FIG. 2). Clearly, TGEV ORF 3A and 3B are not required for TGEV replication in vitro.EXAMPLE 5Analysis of GFP Expression and RT-PCR to Detect Leader-Containing Sub-Genomic Transcripts
At ˜14-18 h post-electroporation, transfected cultures were analyzed for GFP expression by fluorescent microscopy using an Olympus model inverted microscope. High levels of GFP expression from TGEV-GFP2, but not from the wild-type virus, were evident by fluorescence microscopy. Recombinant TGEV-GFP2 was stable for at least 10 high-titer passages in ST cells, as demonstrated by high levels of GFP expression.
GFP expression was observed in 1% of the cells transfected with TGEV-Rep(AvrII) and TGEV-Rep(EcoNI) RNAs, demonstrating that TGEV ORF 3A, ORF 3B, E, and M were not required for subgenomic mRNA synthesis and GFP expression. Transcripts of TGEV-Rep(AvrII) and TGEV-Rep(EcoNI) treated with RNase A prior to transfection did not result in observable GFP expression. Leader-containing subgenomic transcripts should be present that encode GFP and contain the appropriate deletions that were introduced into the replicon cDNAs. Consequently, total intracellular RNA was harvested from transfected cell cultures (pass 0) with Trizol reagent (Gibco BRL, Carlsbad, Calif.) and from cultures inoculated with pass 0 supernatants (pass 1) at ˜36 h post-infection and was used as a template for reverse transcription-PCR (RT-PCR) using primer sets to detect leader-containing transcripts encoding GFP.
RT reactions were performed using SUPERSCRIPT™ II reverse transcriptase for 1 h at 42° C. (250 mM Tris-HCl [pH 8.3], 375 mM KCl, 15 mM MgCl2, 0.1 M dithiothreitol), as described by the manufacturer (Gibco BRL), prior to PCR amplification using Taq polymerase (Expand Long kit; Roche Biochemical, Indianapolis, Ind.). To detect leader-containing GFP transcripts in TGEV-GFP2-infected cells, the 5′ leader-specific primer (nt 1 to 25) TGEV-L (5′-CAC TAT AGA CTT TTA AAG TAA AGT GAG TGT AGC-3′; SEQ ID NO:18) was used with the 3′ primer F:5010(−)(5′-ATT AAG ATG CCG ACA CAC GTC-3′; SEQ ID NO:19), located within ORF 3B at position 24828. To detect leader-containing GFP transcripts derived from replicon RNAs, two different primer sets were utilized. The 5′ leader-specific primer, TGEV-L, was used with the 3′ primer (−)E5546 (5′-GTT AAT GAC CAT TCC ATT GTC-3′; SEQ ID NO:20), located just downstream of the AvrII site within TGEV E at nucleotide position 25866, to amplify across the PflMI-AvrII deletion. To amplify across the PlfMI-EcoNI deletion, the same 5′ leader-specific primer (TGEV-L) was used with the 3′ primer M6400(−)(5′-CAA GTG TGT AGA CAA TAG TCC-3′; SEQ ID NO:21), located just downstream of the EcoNI site within TGEV M at nucleotide position 26624. Following 30 cycles of amplification (94° C. for 25 s, 60° C. for 25 s, 68° C. for 90 s), PCR products were separated on agarose gels and visualized by using Dark Reader technology (Clare Chemical Research). All images were digitalized and assembled by using Adobe Photoshop® 5.5 (Adobe Systems, Inc., San Jose, Calif.).
Appropriately sized amplicons of ˜850 bp were generated from the TGEV-Rep(AvrII)- and TGEV-Rep(EcoNI)-transfected cells (FIG. 3A and FIG. 3B, respectively), corresponding to leader-containing GFP transcripts. Subsequently, the TGEV-Rep(EcoNI) amplicon was isolated and subcloned directly into TOPO® XL TA cloning vectors (INVITROGEN™, Carlsbad, Calif.) as described by the manufacturer. Colonies were isolated on Luria-Bertani plates containing kanamycin (50 μg/ml), and plasmid DNAs were sequenced using an ABI model 377 automated sequencer.
Sequence information confirmed the synthesis of leader-containing GFP transcripts with the PflMI-EcoNI deletion that originated from the ORF 3A TSE. Identical results were seen following TGEV-GFP2 infection, indicating that the 20-nt N gene TSE was silent in this configuration and that the natural ORF 3A TSE was preferentially used in subgenomic mRNA synthesis. Moreover, TGEV iGFP2(ScaI), which has an ATG start codon flanked by the 3A and N gene TSE sites, expressed very low levels of GFP (FIG. 3C). Sequence analysis from over 30 independent clones has confirmed that the GFP subgemonic mRNAs originate from 3A, but not N TSE. This was surprising as: 1) The N gene TSE is the strongest initiator of subgenomic RNAs (Jeong, et al. (1996) Virology 217:311-322; Makino, et al. (1991) J. Virol. 65:6031-6041; Schaad and Baric (1994) J. Virol. 68:8169-8197), and 2) the transcription attenuation model predicts that downstream TSE sites repress expression from upstream sites (Krishnanet al. (1996) Virology 218:400-405; Sawicki and Sawicki (1990) J. Virol. 64:1050-1056). The most likely interpretation of these data is that the N TSE site and its surrounding flanking sequence regulates transcription attenuation of subgenomic RNAs. In the absence of the appropriate flanking sequence, the N TSE is inactive.
In contrast, wild-type TGEV-infected cells yielded multiple amplicons corresponding to leader-containing transcripts carrying TGEV ORF 3A, ORF 3B, E, and M. These transcripts were not detected in TGEV-Rep(AvrII)- and TGEV-Rep(EcoNI)-electroporated cells, respectively, as these genes were completely or partially deleted in the TGEV-Rep constructs (FIG. 1C). Taken together, these data demonstrate the synthesis of subgenomic mRNA and heterologous gene expression from the TGEV-Rep(AvrII) and TGEV-Rep(EcoNI) subgenomic replicon RNAs.EXAMPLE 6Analysis of PRRSV GP5 Heterologous Expression
Previous studies have demonstrated that the PRRSV M protein accumulates in the ER of infected cells where it forms disulfide-linked heterodimers with GP5. Heterodimer formation may be critical in eliciting neutralizing antibody against conformational epitopes (Balasuriya, et al. (2000) J. Virol. 74:10623-30). Using the TGEV 3F subclone (FIG. 4A), GFP was removed by ClaI/PflMI digestion and replaced with GP5 of PRRSV to create icTGEV PRSS GP5 recombinant viruses (FIG. 4A). Recombinant viruses expressed PRRSV GP5 antigen as determined by Fluorescent Antibody analysis and by RT-PCR amplification of the gene (FIG. 4B) using primer pairs within the TGEV leader and PRRSV PG5. Leader-primed GP5 PCR amplicon should be about 750 bp (*; lanes 2 and 3), note the smaller PCR amplicon which likely represents cryptic TSE starts (**).EXAMPLE 7Gene Order Mutants and Transcription
The results provided above suggest that flanking sequences enhance transcription from the N TSE element. To test this hypothesis, GFP was replaced with the TGEV N gene and N TSE site as shown in FIG. 5. TGEV recombinant viruses were isolated that contained two copies of the N gene (TGEV 2N) as well as TGEV SNEM rearranged viruses that lack the “natural N orientation, and express N from the ORF3 position (FIG. 5). TGEV 2N recombinant viruses were viable and replicated efficiently in ST cells(107), demonstrating that gene duplication does not significantly interfere with TGEV replication (FIG. 6). Stability of the TGEV 2N constructs has not yet been studied (Beck and Dawson (1990) Virology 177:462-469). In contrast, the TGEV SNEM gene order mutant TGEV SNEMp4A, purified at passage 4 after the initial transfection, were not robust, only replicating to ˜9.0×104 PFU/ml. After 9 serial passages of the initial transfection progeny, however, TGEV SNEM1 and 4 viruses were isolated that replicated to titers of ˜106 PFU/ml, and each retained N gene expression from the ORF3 position (FIG. 7 and FIG. 8). Sequence analysis has indicated that about 85% of the N gene leader-containing transcripts initiated from the 3A TSE site in TGEV SNEM1, TGEV SNEM4, TGEV 2N-1(PflMI) and TGEV 2N(ScaI) viruses. However, about 15% of the leader-containing transcripts initiated from the N TSE site, supporting the hypothesis that flanking sequences effect N TSE function (FIG. 7)(Alonso, et al (2002) J. Virol. 76:1293-308). These data demonstrate that gene order mutants of TGEV are viable, similar to results described for VSV (Ball, et al. (1999) J. Virol. 73:4705-4712)
To test the hypothesis that compensatory evolution was restoring SNEM virus fitness, TGEV SNEM1 and SNEM4 were serially-passaged 15 times in ST cells. Plaque purified viruses (TGEV SNEM1p15A and TGEV SNEM4p15B) replicated to high ˜107 to 108 PFU/ml, respectively within about 24 hrs postinfection (FIG. 6). Cultures of ST cells were infected and the “TGEV F fragment” of the TGEV SNEM1 and 4 and revertant viruses were cloned and sequenced (see FIG. 8). SNEM virus fitness was not recovered by recombination events that restored the natural gene order. In contrast to the parental replication impaired TGEV SNEMp4A virus, residual ORF 3B sequences were deleted in TGEV SNEM1 (nucleotides 25,287-25,832) and SNEM 4 (25,197-25,833). As the E TSE is located at position 25,813-25,819 (Almazan, et al. (2000) Proc. Natl. Acad. Sci. USA 97:5516-5521), it is apparently not needed for transcription of subgenomic mRNAs encoding the E protein—an essential gene for virion assembly (Fischer, et al. (1998) J. Virol. 72:7885-7894; Vennema, et al. (1996) EMBO J. 15:2020-2028). In TGEV SNEM1 viruses, a related TSE motif ACAAAAC (SEQ ID NO:13), is located at position 25,275-282 and may serve as an E TSE site. However, no obvious E TSE sites are present in the TGEV SNEM4 viruses. It is hypothesized that these deletions have enhanced TGEV SNEM1 and 4 replication by creating a new E transcriptional regulatory sequence (TRS) and thereby, altering transcription of both the TGEV N and E subgenomic RNAs. Importantly, these findings provide additional support for the hypothesis that the core TSE motif ACTAAAC (SEQ ID NO:1), is a junction site and that other flanking sequences function as regulatory sequences of transcription. The TGEV SNEM1p15A and SNEM4p15B revertants have retained the ORF 3B deletions, and also contain different sets of replacement mutations in the E and M glycoproteins. It is not clear how these changes may enhance virus replication or whether additional mutations may be encoded outside of the F fragment. For vaccine purposes, these data indicate that robust gene order rearranged Coronaviruses can be assembled and used as safe heterologous vaccines in swine and other vertebrates.EXAMPLE 8Assembly of TGEV Replicons Encoding GFP
The data presented herein demonstrate that an ORF 3A deletion is not detrimental to stable replication and passage of recombinant TGEV expressing GFP. Consequently, replicon constructs were generated by deleting the E and M structural genes from the previously constructed FiGFP2(PflMI) F fragment (FIG. 1C).
Serial deletions within the TGEV structural gene region were generated from the unique PflMI site at the very 3′ end of the GFP gene and extended for various distances toward the 3′ end of the genome (FIG. 1C). In the first construct (pFiGFP2-AvrII), TGEV ORF 3B and the very 5′ end of the E gene (first 10 nt), including the E gene TSE and ATG start codon, were removed by PflMI-AvrII digestion. After the digestion, the plasmid was treated with T4 DNA polymerase under conditions in which the 5′→3′ exonuclease activity generated blunt ends (according to the manufacturer’s directions; New England BioLabs) and religated using T4 DNA ligase. The result was an ˜800-nt deletion from pFiGFP2(PflMI).
In the second construct (pFiGFP2-EcoNI), ORF 3B, E, and the 5′-most 508 nt of the M gene, including the M gene TSE, were removed by PflMI-EcoNI digestion, treated with T4 DNA polymerase to generate blunt ends, and religated using T4 DNA ligase. The result was an ˜1.5-kb deletion.
The unique AvrII site is located at nucleotide position 25866 within the E protein gene, and the unique EcoNI site is located at nucleotide position 26624 within the M protein gene (Almazan, et al. (2000) Proc. Natl. Acad. Sci. USA 97:5516-5521). Clones containing each of the deletions were identified by restriction digestion analysis and confirmed by DNA sequencing using an ABI model 377 automated sequencer. The new TGEV F fragments (FiGFP2-AvrII and FiGFP2-EcoNI) were subsequently utilized in the assembly of full-length TGEV replicon constructs (FIG. 1C).EXAMPLE 9Replication Competence of TGEV Replicon RNAs
TGEV-Rep(AvrII) lacks all of ORF 3B and a portion of the E gene and therefore should not produce infectious virions. Successful assembly of infectious TGEV from this replicon should be prevented on at least two levels. First, the E gene TSE and flanking sequences have been deleted in this replicon, which should preclude the synthesis of E gene subgenomic mRNA transcripts. Secondly, the E gene start codon has been deleted, and the next possible ATG start codon is out of the E gene reading frame at nucleotide position 25888 and would potentially encode an irrelevant 14-amino-acid protein. However, one possible in-frame E gene start codon is located 33 bp downstream of the PflMI-AvrII deletion, at nucleotide position 25899, and expression from this site would result in a truncated E protein, with about a 17% (14 of 83 amino acids) deletion from the N-terminus, including residues within a putative membrane anchor. Although unlikely, the expression of a biologically active, truncated E protein may result via read-through from other TGEV mRNAs or from cryptic TSE sites that drive expression of a subgenomic mRNA encoding the E protein, allowing for the assembly of infectious virions. This may be unlikely, as cryptic subgenomic leader-containing E transcripts were not detected by RT-PCR that would encode this E protein truncation. To address whether small amounts of truncated E are produced which function in virus assembly and release, aliquots of cell culture supernatants were harvested ˜36 h post-electroporation and passed onto fresh cultures of ST cells (pass 1). By RT-PCR, there was no evidence of virus replication. In addition, virus-induced cytopathology and GFP expression were not apparent in these cultures.EXAMPLE 10Recombinant VEE Replicon Construct
Previous data indicate that the PflMI-AvrII deletion prevented E protein function and the assembly of infectious virus. Consequently, E protein provided in trans should complement the E gene deletion and result in infectious TGEV VRPs. The VEE replicon system has been used previously for the high-level expression of a number of heterologous genes (Balasuriya, et al. (2000) J. Virol. 74:10623-10630; Caley, et al. (1997) J. Virol. 71:3031-3038; Hevey, et al. (1998) Virology 251:28-37; Pushko, et al. (2000) Vaccine 19:142-153; Pushko, et al. (1997) Virology 239:389-401; Schultz-Cherry, et al. (2000) Virology 278:55-59) and was used as an efficient means for expressing the TGEV E protein in trans. It was hypothesized that VEE VRPs expressing TGEV E would supply sufficient concentrations of E protein in trans to allow for efficient assembly and release of packaged TGEV-Rep(AvrII) VRPs (FIG. 9). To determine the effect of VEE VRPs on TGEV replication, cultures of ST cells were either infected with wild-type TGEV alone or coinfected with VEE VRPs containing a G1 VEE-NCFL capsid gene (Harrington, et al. (2002) J. Virol. 76:730-742) and wild-type TGEV. Progeny TGEV virions were harvested at different times post-infection and quantified by plaque assay in ST cells (FIG. 10). Clearly, the TGEV growth rate was not adversely affected by co-infection with VEE VRPs. Similar results have been shown with another alpha-virus, Sindbis virus, and the murine coronavirus mouse hepatitis virus (MHV) (Baric, et al. (1999) J. Virol. 73:638-649).
The TGEV E gene was inserted into the VEE replicon vector pVR21, kindly provided by Nancy Davis and Robert Johnston (Balasuriya, et al. (2000) J. Virol. 74:10623-10630). Using overlapping extension PCR, the TGEV E gene was inserted just downstream of the subgenomic 26S promoter within the multiple cloning site of pVR21. Using the Expand Long Template PCR system (Roche Molecular Biochemicals), the TGEV (Purdue strain) E gene was amplified from the TGEV F fragment by 30 cycles of PCR (94° C. for 25 s, 60° C. for 25 s, 72° C. for 1 min) by u the TGEV E(V+) 5′ primer (5′-AGT CTA GTC CGC CAA GAT GAC GTT TCC TAG GGC ATT G-3′; SEQ ID NO:22) and the AscI site-containing TGEV E(V−) 3′ primer (5′-GGC GCG CCT CAA GCA AGG AGT GCT CCA TC-3′; SEQ ID NO:23). In addition, a segment of the pVR21 vector containing a unique SwaI site followed by the 26S subgenomic promoter was amplified by PCR by using the 6198V primer (5′-GCA AAG CTG CGC AGC TTT CC; SEQ ID NO:24) with the (−)7564V primer (5′-CAT CTT GGC GGA CTA GAC TAT GTC GTA GTC CAT TCA GGT TAG CCG; SEQ ID NO:25). Appropriately-sized amplicons were isolated on agarose gels and extracted as previously described (Yount, et al. (2000) J. Virol. 74:10600-10611).
The 5′-most 19 nt of primer (−)7546V were complementary to the 5′-most 19 nt of the 5′ TGEV E(V) primer, allowing for the adjoining of the two amplicons by overlapping PCR. Using the Expand Long Template PCR system, reactions were performed and consisted of 30 cycles of 94° C. for 20 s, 58° C. for 30 s, and 68° C. for 2 min, with the first 5 cycles done in the absence of primers. The resulting amplicon, containing unique SwaI and AscI restriction sites at its 5′ and 3′ ends, respectively, was isolated and purified as previously described. Following AscI and SwaI restriction digest (unique to both the TGEV E amplicon and pVR21), the TGEV E gene was inserted into the pVR21 vector. The resulting recombinant VEE replicon vector (pVR21-E1) was cloned, and the sequence was confirmed using an ABI model 377 automated sequencer. pVR21-E1 was subsequently used for the production of VEE VRPs expressing the TGEV E protein [VEE-TGEV(E)].
A bipartite helper system consisting of two helper RNAs derived from the V3014Δ520-7505 monopartite helper was used for the construction of VEE replicon particles (Pushko, et al. (2000) Vaccine 19:142-153). These helper RNAs express the individual capsid and glycoprotein genes of VEE, thereby supplying the structural genes in trans.EXAMPLE 11Recombinant VEE VRP Production
The recombinant VEE replicon construct (pVR21-E1) was linearized at a site downstream of the VEE cDNA sequence by NotI digestion, and T7-capped runoff transcripts were generated in vitro by using the T7 mMessage mMachine™ kit as described by the manufacturer (Ambion). Recombinant VEE replicon and helper RNAs were co-electroporated into BHK cells and incubated at 37° C. in 5% CO2 for ˜24 to 27 h. Cell culture supernatants were harvested and clarified by centrifugation at 12,000×g for 15 min. Recombinant VEE VRPs (VEE-TGEV[E]) were partially purified, concentrated, and resuspended in PBS as previously described (Davis, et al. (2000) J. Virol. 74:371-378). Although we were unable to quantitatively identify the presence of VEE-TGEV(E) VRPs due to our lack of anti-E antibody, a qualitative analysis was performed. BHK cells were infected with purified VEE-TGEV(E) VRPs for 1 h at room temperature. VRP titers were high as cytopathic effects were evident in 100% of the transfected cultures, suggesting titers of >108 VRP/ml, and transcripts encoding TGEV E were present in infected cells as detected by RT-PCR amplification of leader-containing transcripts.EXAMPLE 12Packaging of TGEV Replicon RNA
Two methods were used to supply TGEV E in trans, allowing for the packaging of TGEV-Rep(AvrII) replicon RNA. In the first method, TGEV-Rep(AvrII) replicon RNA and the helper RNA derived from pVR21-E1 were co-electroporated into BHK cells. In the second method, BHK cells were first electroporated with in vitro-transcribed TGEV-Rep(AvrII) RNA (pass 0), seeded onto 75-cm2 flasks of ST cells, and at 3 h post-electroporation, subsequently infected with recombinant VEE-TGEV(E) VRPs for 1 h at room temperature. Cultures were visualized for GFP expression by fluorescent microscopy at ˜18 h post-electroporation. In both methods, GFP expression was evident by fluorescent microscopy, demonstrating the subgenomic transcription and heterologous gene expression from the TGEV-Rep(AvrII) genome in the presence of VEE replicon RNAs. Conversely, passage of supernatants from cells tranfected with TGEV-Rep(AvrII) transcripts without expression of the E protein in trans did not result in detectable GFP expression.
Cell culture supernatants were harvested ˜36 h post-transfection and undiluted aliquots were used to inoculate fresh cultures of ST cells cultures (75-cm2 flasks) (pass 1) for 1 h at room temperature to determine if the TGEV-Rep(AvrII) replicon RNA had been packaged into TGEV VRPs. Successful packaging and passing of TGEV-Rep(AvrII) replicon RNA were determined by GFP expression, and RT-PCR analysis was performed to detect leader-containing GFP transcripts, as described above. By ˜18 h post-infection, GFP expression was observed in these pass 1 cultures, confirming that replicon RNAs had been packaged into infectious TGEV VRPs. However, TGEV VRP titers were low, estimated to be 103 to 105 infectious units/ml by fluorescent microscopy, depending on the experiment. TGEV VRPs should express leader-containing subgenomic mRNAs encoding GFP and the various downstream ORFs, including M and N. Following TGEV VRP infection, intracellular RNA was isolated and subjected to RT-PCR by using primer pairs in the leader RNA and downstream of the GFP, M, and N genes. For this RT-PCR, primer TGEV-L 5′ was used in conjunction with the 3′ primers TGEV-Mg (5′-AGA AGT TTA GTT ATA CCA TAG GCC TTT ATA CCA TAT GTA ATA ATT TTT CTT GCT CAC TC-3′; SEQ ID NO:26), located at position 26870 within the M gene, and TGEV-Ng (5′-CCA CGC TTT GGT TTA GTT CGT TAC CTC ATC AAT TAT CTC-3′; SEQ ID NO:27), located at position 28038 within the N gene. Briefly, RT reactions were performed by using Superscript™ II reverse transcriptase for 1 h at 42° C. (250 mM Tris-HCl [pH 8.3], 375 mM KCl, 15 mM MgCl2, 0.1 M dithiothreitol), as described by the manufacturer (Gibco BRL), prior to 30 cycles of PCR amplification using Taq polymerase (Expand Long kit; Roche Biochemical) (94° C. for 25 s, 58° C. for 25 s, 68° C. for 1 min and 40 s). PCR products were separated on agarose gels, cloned, and sequenced as previously described.
As in the previous TGEV-Rep(AvrII) experiments, a leader-containing GFP amplicon of ˜850 bp was generated (FIG. 11A) and sequenced to confirm the presence of leader-containing GFP transcripts with the PflMI-AvrII deletion. Leader-containing subgenomic transcripts were also detected that contained the TGEV M and N genes, ˜900 bp and ˜1.2 kb, respectively (FIG. 11B), demonstrating that transcripts for at least two of the structural genes were expressed in TGEV VRP-infected cells. Larger leader-containing amplicons were also observed and likely corresponded to cryptic start sites noted within GFP as well as the larger GFP leader-containing amplicons (FIG. 11B). These data demonstrate the replication competence and heterologous gene expression from packaged TGEV-Rep(AvrII) RNAs.EXAMPLE 13TGEV Replicon Particles Function as Single-Hit Virus Vectors
An important aspect of viral replicon particle systems, in terms of future use as an expression vector for vaccine development, is the lack of recombinant virus production. It is possible that mutations may evolve which restore E protein expression and function or recombinant TGEVs emerge following mixed TGEV-Rep(AvrII) and VEE-TGEV(E) infection. To conclusively demonstrate the lack of recombinant virus production from the E deletion replicon RNA, 60-mm2 cultures of ST cells were infected for 1 h at room temperature with TGEV VRPs obtained from previous TGEV-Rep(AvrII) packaging experiments (clarified and concentrated by high-speed centrifugation as previously described (Davis, et al. (2000) J. Virol. 74:371-378), overlaid with fresh media, incubated at 37° C., and subsequently examined over a 72-h time period for GFP expression by fluorescent microscopy as well as virus production by plaque assay in ST cells. Under identical conditions, supernatants obtained from cell cultures transfected with TGEV-GFP2 transcripts were passaged onto fresh ST cells and examined for virus replication by GFP expression, for cytopathic effects, and by plaque assay, as previously described.
Expansion of GFP expression was clearly observed in TGEV-GFP2-infected cells while no expansion was noted in TGEV VRP-infected cells. In fact, GFP expression in these TGEV VRP-infected cells eventually decreased after the 24-h time point and eventually disappeared. Additionally, infectious TGEV particles were not detected by plaque assay in TGEV VRP-infected cultures during this same 72-h period (FIG. 12), while infectious TGEV-GFP2 virus rapidly reached titers of 2×106 PFU/ml by 48 h post-infection under identical conditions. These data clearly demonstrate the lack of revertant wild-type and recombinant virus production from the TGEV-Rep(AvrII) VRP stocks.
The foregoing examples are illustrative of the present invention, and are not to be construed as limiting thereof. The invention is described by the following claims, with equivalents of the claims to be included therein.
Claims
1. A helper cell for producing an infectious, replication defective, coronavirus particle, wherein said cell is a coronavirus permissive cell, comprising:(a) a coronavirus replicon RNA comprising a coronavirus packaging signal, and a heterologous RNA sequence, wherein said replicon RNA further lacks a sequence encoding at least one coronavirus structural protein; and(b) at least one separate helper RNA encoding the at least one structural protein absent from the replicon RNA, said helper RNA lacking a coronavirus packaging signal.wherein the combined expression of the replicon RNA and the helper RNA produces an assembled coronavirus particle which comprises said heterologous RNA sequence, is able to infect a cell, and is replication defective.
2. The helper cell according to claim 1, said replicon RNA further comprising a sequence encoding at least one of the coronavinis structural proteins.
3. The helper cell according to claim 1, wherein said helper RNA contains at least one gene encoding a structural protein selected from the group consisting of the E, M, N, and S genes.
4. The helper cell according to claim 1, wherein said helper RNA contains the E gene.
5. The helper cell according to claim 1, wherein said coronavirus is selected from the group consisting of human respiratory coronavirus, mouse hepatitis virus, porcine transmissible gastroenteritis virus, porcine respiratory coronavirus, canine coronavirus, feline enteric coronavirus, feline infectious peritonitis virus, rabbit coronavirus, murine hepatitis virus, sialodacryoadenitis virus, porcine hemagglutinating encephaloinyclitis virus, bovine coronavirus, avian infectious bronchitis virus, and flu-key coronavirus.
6. The helper cell according to claim 1, wherein said coronavirus is transmissible gastroenteritis virus.
7. The helper cell according to claim 1, wherein said replicon RNA contains at least one attenuating gene order rearrangement among the 3A, 3B, HP, S, E, M and N genes.
8. The helper cell according to claim 1, wherein said helper RNA includes a promoter.
9. The helper cell according to claim 1, wherein said replicon RNA includes a promoter.
10. The helper cell according to claim 1, wherein said heterologous RNA is selected from the group consisting of RNA encoding proteins and RNA encoding peptides.
11. The helper cell according to claim 1, further comprising a heterologous DNA encoding said helper RNA.
12. The helper cell according to claim 1, further comprising a heterologous DNA encoding said replicon RNA.
13. A method of making infectious, replication defective, coronavirus particles, comprising:providing a helper cell according to claim 1;producing said coronavirus particles in said helper cell; and thencollecting said coronavirus particles from said helper cell.
14. The method according to claim 13, wherein said coronavinis RNA and said at least one separate helper RNA are introduced into said helper cell by electroporation.